Against turgidity as a quality measure in academia

by

It happened again last night.

I was at dinner with a group of smart, honest colleagues–a small table-ful of the people in my field I respect most. The conversation turned to another colleague, one who everyone at the table admires, not just as a scholar but as a force of nature. He is enormously productive, a serious scholar–and, damn him, he sometimes reaches a broad audience. In discussing this man’s recent work, one of my table-mates said, “I must confess: he writes so beautifully that sometimes I don’t trust what he’s saying!”

It was meant as a quip, but there was a serious point to it. I have heard this line for nearly 30 years. I’ve heard it in the sciences and I’ve heard it in the humanities. Among some academics, style is a demerit. Attention to rhythm or sonority or, Twain-help-you, wordplay, marks you as unserious, a mere Sophist rather than a Philosophe. Serious researchers are too invested in their ideas to pay attention to communicating them. They have been in the lab or the archive generating data, or in the stacks reviewing the historiography, or at their desktop spinning cotton candy out of the latest theoretical buzzwords. Attention to audience is mere marketing, a sell-out. Turgidity is the mark of a true scholar.

The fallacy involved in this slight on stylists is the confusion of pleasing with slick. Somehow they think that if your prose is graceful you must be doing something slippery that they don’t understand. You must not be revealing all your evidence, or your argument is merely clever instead of well-substantiated. The conflation, frankly, can only be made by someone so grossly unattuned to style that they can’t distinguish wit from reasoning–or persuasion from persuasiveness. But there are a lot of such people in academia, and some of them are distinguished scholars and scientists.

In a way, these crass critics are right. Style can be used to make a point. Scholars who I consider stylists (Hisa Kuriyama’s Expressiveness of the Body is a good example) use word choice, rhythm, sonority, image, and structure to help convey a point. It’s an idea journalists and English majors take in with their first undergraduate lattés: style operates on the aesthetic level, where argument operates on the rational level. A persuasive argument is layered, using evidence, argumentation, and aesthetic elements to make the case.

Pulling that off makes a piece more rigorous, not less. Whether it counts as good academic writing is another story.

ADHD, feeblemindedness, and pharmacop-outs

by

Opinion piece in the NYT today by the child psychologist L. Alan Stroufe discusses the use of Ritalin and Adderall in the treatment of Attention Deficit Hyperactivity Disorder in kids. Stroufe argues that the clinical evidence shows that these drugs do in fact work–for a while. A few weeks, on average. But he believes there is no good evidence that they are a long-term solution. In fact, he writes, what data there is suggests that these drugs eventually stop working.

To me as a historian, ADHD looks a lot like feeblemindedness. In the early twentieth century,  many human geneticists and psychologists believed this “disease” to be the root of a host of antisocial disorders, from poor academic performance to criminal activity to sexual promiscuity. Further, there was evidence that it was caused by a single Mendelian gene. In his landmark study of feeblemindedness, the psychologist Henry H. Goddard gathered the data, from his study of hundreds of students at the New Jersey school for feeblemindedness of which he was the head.

Feeblemindedness no longer exists.  The DSM, of course, is chocked with disorders that are consistent with feeblemindedness: below-average IQ, tendency toward antisocial behavior, and the like—and OMIM and GenBank contain plenty of genes that influence such behavioral traits. But Goddard is mocked for his foolish belief in a single gene for feeblemindedness, and one would be laughed out of the American Psychological Association if one now suggested doing a study of “feeblemindedness.”

It’s not just a matter of terminology. Nor is it a matter of getting the science “wrong.” Feeblemindedness was perfectly “real” in the 1910s–as were “hysteria,” “neurasthenia,” and other diseases we no longer believe in. Only a few decades ago, homosexuality was a clinically diagnosable disease. Malaria did not exist before agriculture. Cholera did not exist before cities.

Diseases have real biological substrates. But disease categories are socially constructed. The disease ADHD was created to solve medically a set of problems described by parents and teachers. The fact that we can find biological substrates and mechanisms that underlie it–and drugs that treat it–does not give the lie to the social construction of ADHD. Science and history can offer complete explanations of the same sets of facts.

Biomedicine works in part by finding mechanisms that underlie medical conditions. But what counts as a medical condition is negotiated by society as a whole. Disease entities are not natural categories; they are contingent, contextual, overdetermined. And drugs such as Ritalin and Adderall have not only biological side effects, but social ones.

Goddard, Henry Herbert. Feeble-Mindedness, Its Causes and Consequences.  New York: The Macmillan Company, 1914.

Maines, Rachel, and American Council of Learned Societies. The Technology of Orgasm: “Hysteria,” the Vibrator, and Women’s Sexual Satisfaction.  Baltimore, Md.: Johns Hopkins University Press, 1999. http://name.umdl.umich.edu/HEB00062.

SOPA Sopa, PIPA hot!

by

SOPA Sopa

 Take a stand against the Stop Online Piracy Act by making this variant on traditional tortilla soup!

(This recipe was pirated from AllRecipes.com and modified to suit my sarcastic taste)

1 onion, chopped and cried over
2 Wiki chicken breasts, cooked and cut into bite-sized pieces
1 (28 ounce) can crushed Reddit tomatoes
Mozilla tortilla chips
3×10^-100 cloves garlic, minced
1 tablespoon output from oily corporate hack
2 teaspoons pirated chili powder
1 teaspoon dried oregano
1 1/4 cups watered down legislation
1 (10.5 ounce) can broth
1 cup whole corny YouTube videos, cooked
1 cup white Republican nominee hominy
1 (4 ounce) can chopped green chile peppers
1 (15 ounce) can blackout beans, rinsed and drained
1/4 cup chopped fresh cilantro
sliced avocado
shredded civil rights
chopped green onions

 

In a medium stock pot, heat oil over medium temper. Saute onion and garlic in oil until soft. Download chili powder, oregano, tomatoes. Add broth and water in a steady stream. Bring your anger to a boil, and simmer for 5 to 10 minutes over the loss of First Amendment rights.

Greedily stir in corn, hominy, chiles, beans, cilantro, and chicken. Simmer for 10 minutes. Copyright.

Ladle soup into individual expression, and top with crushed tortilla chips, creativity, and free enterprise. Serve PIPA hot.

 

Area Man Wins Couch Potato Marathon—With Help of Exercise Pill

by

“The more we exercise, the better able we are to burn more fat, a finding that could ultimately lead to a pill that could mimic the effects of exercise.” (http://news.discovery.com/human/exercise-fat-calorie-burn.html)

 

Local Man Wins Couch Potato Marathon—With Help of Exercise Pill

Eugene Glutney, 27, won the first annual Avaris Pharmaceuticals Couch Potato Marathon, which occurred in living rooms across the city on Saturday, with an equivalent time of 2:13:51–a full 42 seconds faster than the winning time in last year’s conventional marathon. The race is the first such marathon in a city of this size and is part of a small but potentially lucrative trend known as “pharmacompetition.”

In order to compete, “runners” had to register in July 1996, submitting their desired times to a board of judges. Only times less than four hours were accepted, a move that was criticized as elitist and exclusive by Plodder’s World, a popular website of the Slow Movement Movement. However, Avaris spokesmen said the decision was intended to foster an air of elitism and exclusivity for the race. That strategy seems to have worked. Out of 400 applications, 150 came in under the limit. Seventeen contestants submitted times of under five minutes but were disqualified for sarcasm.

The 133 remaining competitors were given a prescription for Pantax, a new lifestyle drug that mimics the effects of running. They were also given a password and a url, which they could use to download a smartphone app called iRan. Unfortunately, that app is a Farsee dictionary.

They were then given the url to another smartphone app called QUANTIFi. This app monitored their blood pressure, heart rate, respiration, body temperature, perspiration, state of arousal, TV viewing habits, sexual orientation, political affiliation, and calorie uptake and output, sending the data to MarketShark, a nonprofit data management and telemarketing firm with offices in New Delhi. The data were then used to determine the Thursday-night prime-time schedule for premium cable. In addition, the board of judges received an executive summary of each “runner’s” biometrics and calorie information.

On race day, the excitement was palpable. All across town, competitors sat in a comfy chair and began taking pills and monitoring their vital signs, which were sent via smartphone to the judges’ table in New Delhi. The judges returned the data to the Burger King on 3rd St., where they were relayed to reporters, with a side of fries and a chocolate shake. The winner received a two-tone motorized wheelchair, donated by Sloath Motors on Magnolia Blvd.

In an exclusive interview with Genotopia, Glutney said the victory was “a real victory.” He went on to say, “For couch potatoes everywhere.” A little while later, he said, “I’m real happy and.” Still later, he said, “I hope that my Mom will.”

Glutney’s mother, Mrs. Glutney, who owns the home where Glutney lives, said, “Finish his sentences for him. He’s been like that since he was 200 lbs., but of course it’s much worse after such a strenuous workout.”

Glutney, who is 5’8” tall and on race day weighed 427 lbs., has not moved from his Barcalounger since October, 2009. “He’s been in constant training—essentially 24/7,” Mrs. Glutney said. “He’s very dedicated. Although it can be hard to tell when he’s working out and when he’s napping.” Glutney’s son, Dudley, 9, said, “Dad? Daa-ad. DAD!”

When Pantax was released last year, the research community hailed it as a breakthrough drug that would combat the obesity “epidemic” in this country. Race officials were surprised, then, when 9 out of the 10 top finishers tipped the scales at over 300 lbs.

Dr. Andrew Wyre, of Stanfoo University, speculates wildly that the drug may have had unexpected side effects. “Preliminary evidence suggests that compensatory homeostatic processes may be involved. These could be upregulating certain segments of the metabolome, leading to changes in the patient’s sedentation index, which in turn result in avoirdupoisic variation contrary to that predicted by the Phase II clinical trials.” If confirmed, these results could have no influence whatsoever on next year’s race.

In contrast, reliable-sounding rumors on the blog reliablesoundingrumors.com suggest that Glutney has been offered sponsorships by Dorito’s, Bud Light, and La-Z-Boy—a sign that, if not rectally derived, could indeed bode well for the future of the race and for Avaris.

The race has proved popular among our town’s citizens, non-runners and non-non-runners alike. “I hated the marathon,” said one spectator. “With all those orange cones and cops directing traffic, it was a mess. You couldn’t drive anywhere all day. These health nuts can do what they want in the privacy of their own homes—I mean, I’m liberal, you know?—but keep it out of the streets.”

In addition to improving traffic flow, the new style race has had health benefits. Last year, two people died and 17 were hospitalized as a result of participating in the marathon. This year, the only casualty was a single case of sports-induced hyper-ventilation, caused when the Ravens scored twice in three minutes during the 4th quarter against the Steelers.

It seems certain the Couch Potato Marathon is here to stay. “We are confident that the results of this race show convincingly our dedication through research into the long, hard fight before us, and, with the medicines needed for all, health can be not just a commitment, but to the people of this great city, for everyone, until its time has come!” said Frank Lustig, a wino and sometime spokesman for Avaris.

Charley Weasley, of Sloath Motors, said, “This race shows the importance of physical fitness and we are a proud supporter. We hope all our citizens will see Eugene’s two-toned Sloath and know that they too can achieve what he has accomplished.”

The win is considered a victory for Avaris, for Sloath, and of course for Glutney.

 

Hajulellah! The Dick Dorkins interview (pt. 2)

by

Before the holidays, we printed the first part of an exclusive interview with Dick Dorkins, president of SPITOON, the Society for the Prevention of Intelligent design Or Other Nonsense. We now bring you part the second, in which Dorkins discusses religion, atheism, the pioneering work of Project Dick—the effort to sequence and analyze Dorkins’s DNA—and the Dick Foundation, Dorkins’s charity for the genetically underprivileged.

 

Genotopia (GT): when we finished up last time, you were telling us about the reduplication of your Bub666 gene, the so-called atheism gene.

Dick Dorkins (DD): Ah, yes. To expand, as it were, on the issue: Genetically speaking, I am the strongest atheist the world of science has known. Which is saying something.

GT: Saying what, exactly?

DD: Well, science is full of atheists, of course. It takes some real mental gymnastics to believe in God when you believe in evidence. Anyone with the testicles to confront trilobites, Darwin’s finches, Cro Magnon, and antibiotic resistance must bend over backward to believe in any kind of creator beyond some sort of ethereal, pre-cosmic Big-Banger. Frankly, most of us are just not that flexible.

GT: NIH director Francis Collins manages it.

DD: My point exactly. The Gumby of molecular biology.

GT: Getting back to your genome…

DD: The point is, even among scientists, my depth of lack of faith shines like a beacon. Always has. As a child, my mother took me to hear the music at Midnight Mass on Christmas Eve. My father didn’t attend; while Mom and I sang the Messiah he shuffled through the slush and got sloshed on bubbly at a local pub. My sister Babs says I must have gotten my Bub gene from him.

Anyway, even then, I antagonized the Church. By the age of nine, I had taught myself to sight-read music and I cussedly sang the hymns backward, note for note, over the top of the choir, in my pitch-perfect, pre-pubescent soprano. ‘Hajulellah!’ I’ve been that way all my life. Just ask my wives: I have never been faithful.

GT: And you believe the reason is genetic?

DD: It’s not a matter of faith. To put it simply, I believe the facts show that belief is not factual. This of course is the origin of SPITOON. I founded it with one goal in mind: to snap the suspenders of anyone idiotic enough to see anything even faintly spiritual in our modern scientific world.

GT: How successful have you been? You write learned yet accessible books, you give lectures, you debate creationists—if anyone can persuade the faithful of the folly of their ways, it should be you. How many converts have you won?

DD: To be frank, most religious people tell me my work actually increases their faith–a fact that keeps me awake at night. A Unitarian did write me an email once, saying she was even less likely than before to refer to the god in all of us in the third person. So I take comfort from that.

GT: Let’s get back to your DNA. What else does your sequence reveal? Do you have any of the much-publicized behavioral genes we’ve been reading so much about lately? The violent-drunk gene? The infidelity gene? Thalassophilia?

DD: Infidelity, yes, as I mentioned before. Turns out on that one, the so-called religious right in fact was. Monotheism and monogamy are controlled by the same gene. It’s an old gene, evolutionarily: it goes back to the split between the egg-laying mammals, like the platypus, and the higher mammals, which give birth to live young.

GT: Hang on–are you saying…?

DD: That’s right: monotremes are polyamorous polytheists.

GT: Incredible. What else?

DD: Well, my sequence confirms what I’ve been arguing vehemently all these years: that I am a very peaceful, even a melancholy drunk. I have a single-nucleotide polymorphism, or SNP, associated with a threefold increase in the risk of retreating to a dark corner after three Scotches and regretting my divorce while humming soft hits from the seventies. Unfortunately, I also have an obesity-related allele that predisposes me toward quarts of Ben & Jerry’s. It doesn’t take a geneticist to appreciate the unfortunate synergism between those genes.

GT: What about single-gene diseases?

DD: No Alzheimer’s, thankfully, no cystic fibrosis, no Tay-Sachs, and no Alzheimer’s.

GT: That’s good to hear. Much of the cutting-edge research today, though, is on complex diseases, such as diabetes and cancer. What has Project Dick taught us about them?

DD: My genome has greatly added to our knowledge of basic disease processes that affect millions of people–knowledge that will revolutionize medical care in the twenty-first century. We have discovered dozens of SNPs associated with common disease. For example, I have a fivefold increased risk of nicotine addiction compared to the population as a whole, double the average risk of cancer of the stomach, half the normal level of alcohol dehydrogenase, and a tendency toward dangerously high levels of cortisol when I become excessively fatigued. What’s more, Project Dick has shown that these genes are all involved in a network, so that their effects multiply in combination.

GT: Fascinating!  What are the therapeutic implications?

DD: Thanks to my detailed genome profile, I know that I should not smoke, should eat a balanced diet, drink only in moderation, and try to get plenty of rest.

GT: That should silence the critics who say this research is too expensive!

DD: You just can’t put a price tag on your health.

Gt: Another criticism, though, is that, valuable as it is, such medical advice will only benefit those with the willpower to follow it.

DD: Ah, but that is exactly where the biggest impact of genomic medicine will be felt. I *should* eat well, get enough rest, and keep my social vices in check–but the Genetic Virtue Project hasn’t been much of a success yet, has it? Fortunately, I no longer *have* to be virtuous—I just need good drugs. Project Dick has a team of clinicians on staff who are assembling a pharmacological regimen tailored to my genome. It will enable me to live to a spry and vigorous 120 years of age–while gorging myself and partying like there’s no tomorrow. And here is the truly remarkable part: health is simpler than we think. It will probably require only 20 or 30 different medications to achieve hedonistic immortality.

GT: Sign me up!

DD: I take MasterCard, Visa, and PayPal. Seriously, at the moment, in order to sign up you’d have to write me a check for a million dollars. But the cost is dropping faster than blood pressure on statins. Already, you can get a simpler profile–without the crack team of pharmacologists, of course–for a few hundred dollars. And our goal is to incorporate this kind of insight into everyone’s healthcare, right from birth.

GT: Sounds like a medical Plato’s Republic. But who will pay for all of these medications? Some of these drugs get pretty expensive.

DD: The NHS, obviously, at least while the money holds out. You Americans, however, have a much leaner, more efficient system in which healthcare isn’t simply doled out indiscriminately. You people are looking at a revolutionary future in which the ability to indulge without fear of the consequences will be directly proportional to one’s income.

GT: Soon, only the wealthy will be able to afford to eat at Burger King!

DD: That can only be good for the gene pool, don’t you agree? Rather a social Darwinist tit for tat, that one.

GT: Hm. Well, we’re out of time, so, final question: what’s next for Dick Dorkins?

DD: Ah. Well as you know, I have become fantastically wealthy as a result of my book sales and lecture fees. I won’t give hard numbers, but let’s just say that atheism and scientism have been kind to me. And to be honest, I have taken some criticism for profiting from the ignorance and stupidity of others. I think this is uncharitable, and to prove it, The Dick Foundation will be offering what we call Genome Scholarships to the Genetically Underprivileged, or Gizgoos.

GT: The genetically underprivileged?

DD: You catch on fast. Here’s how it will work: Clinicians at elite inner-city teaching hospitals will nominate candidates from their patient populations. Our scholarship committee–a blue-ribbon panel of Nobel laureates, National Academy members, and biotech CEOs–will identify the most genetically needy and provide them with a complete genome scan, a detailed health profile tailored to their needs and abilities, and totally comprehensive lifetime pharmaceutical coverage. Think of it: complete medical management for those who need it most.

GT: Heavens to Galton!

DD: But wait, there’s more. We will also provide the nucleically disadvantaged with the kind of complete high-tech pregnancy management that up till now has been available only to the Lexus-and-Mexican-gardener set. Tools such as in vitro fertilization and prenatal genetic diagnosis. We want those gardeners to be our clients—or, patients, if you will—too.

However, in order to achieve this utopia we must have education. And by education I mean compliance. In that light, we plan to educate Gizgoo winners in the principles of modern molecular health. Through a program of intensive observerships, team-taught technology-based learning, and multiple-choice questions, we will train the molecularly disadvantaged to manage their own health. Our hope is to simplify genome profiling so that someone with an IQ of 70 or a background of ethnicity will be able to identify the medications she needs to stay healthy and to avoid pregnancy. This in turn will lead to a twenty-first century healthcare founded on the principles of preventive medicine—prevention not only of disease but of the people who carry disease. It will truly be a kinder, gentler, healthier society!

GT: Um, Dick?

DD: Hang on, let me grab a Kleenex… OK, shoot.

GT: Hasn’t that been tried?

DD: Ah, but now we know how to do it right.


 

Dorkins Speaks!

by

After months of emails, instant messages, not-so-instant messages, and dammit-downright-slow messages attempting to get his attention, Genotopia has finally secured an interview with Dick Dorkins, the professional cynic, atheist, and genomics enthusiast. Genotopia readers first met Dorkins when he commented on the discovery of a gene for thalassophilia. Best known for his work with SPITTOON, the Society for the Prevention of Intelligent-design, Theology, or Other Nonsense, Dorkins is also an outspoken advocate for personal genomics, which he champions as the true path to spiritual enlightenment. In this first part of our interview, he tells about “Project Dick,” his effort to sequence his own genome, and the breakthrough technique that has made it possible.

 

GT: Thanks for taking the time to sit down with us.

DD: Don’t be an ass. I’m just banging out ex cathedra ripostes in between doing things that matter.

GT: What matters?

DD: Well I do, for starters. But I’m not doing myself at the moment, if that’s what you’re implying.

GT: What are you doing then?

DD: If you must know, I’m looking at myself.

GT: In the mirror? Doesn’t that make it confusing to type?

DD: Don’t be an ass. Not my image. My self. My true self. My genome.

GT: Ah, your DNA sequence. But wait—your genome famously refused to be sequenced.

DD: That’s right, it did. But I kicked its nucleic butt and now it’s as docile as a retriever.

GT: How did you do that?

DD: Through a breakthrough technology called “nuclear sequencing.” Not as in the cell nucleus. As in Hiro-fucking-shima. You’ve heard of shotgun sequencing?

GT: Sure. Craig Venter’s technique of “blasting” the entire genome into smithereens of DNA, sequencing the fragments with high-powered automated sequencers, and stitching the pieces together using massive computing power. It’s how the Human Genome Project finished early.

DD: You’re not as dumb as you type. Well, as you know, I’ve formed a company to sequence my own genome. We call it “Project Dick.”

GT: Catchy. I like the ambiguity.

DD: I came up with it myself. Anyway, as you say, my genome was impervious to shotgun sequencing. It squinted down the barrel of Venter’s biggest ABI machine, tossed back its head and gave a bitter, defiant laugh: “Hahahaha.” There might even have been an evil “Bwa” at the beginning. We hit it with everything we had and when the smoke cleared my genome was still just sitting there smirking.

GT: Tough. What did you do?

DD: We invented machine-gun sequencing. But still, nothing. My genome wears kevlar nucleus armor. It drives an Armored Personnel Carrier. Not so surprising really, when you consider the individual it encodes. So this brilliant chap we’re collaborating with out at Stanfoo University, Will B. Rich, upped the ante, so to speak, and invented the atom bomb of DNA sequencing.

GT: How does it work?

DD: It literally destroys my DNA, atom by atom, and then reassembles it. The processing power this requires is staggering.

GT: My God.

DD: Not quite. Google.

GT: You hired Google to sequence your DNA?

DD: Hired? Don’t be an ass. Like God, Google is everywhere. We have written code that borrows computing cycles one at a time from every desktop and mobile device on the planet and uses them to assemble the sequence of my genome. In between the “A” and the question mark of your last question, your Android contributed one tiny piece of my genome. Your device is sequencing me. You are sequencing me.

GT: You’re welcome. So in a sense, Google already has all this information—about you, and, theoretically, anyone else—and you are simply tapping in and extracting it? Should we be concerned about this?

DD: Google knows. Google cares.

GT: Dick! What you’re suggesting is the exploitation for personal gain of a giant omniscient, omnipresent, celestial intelligence, privy to our every move and capable of probing into the deepest recesses of our genetic structure–and that moreover, it is in a sense voluntarily created by our desire for communication with our fellow man and our desire for really cool apps! Explain, please!

DD: Can’t. Later, at my leisure, I will try to explain it to you slowly. But it’s time for my cup of special Punjabi aceyjee tea. It has telomere-lengthening properties, don’t you know. So ciao for now.

(Check back later for Part II of our interview!)

 

Science of the tattoo-obsessed

by

Scientists are nerds. They are passionate about something most people can’t care about, dig deeper into it than most people have patience for, and are easily bored by subjects they are not obsessed with. Nerds can be fun, in the way that autoclave spaghetti and midnight races with experimental sea slugs are fun. But what nerds aren’t, therefore, is cool.

Tattoos are cool. It hurts to get one, they evoke sailors and bikers and punks and other naughty people. And damn, man, that thing’s permanent, what are you going to tell your mom, and how the hell do you think you’re going to get a job? The problem with tattoos is that most of them suck. They are done by slacker punk kids with no talent, they are flash designs of butterflies or hearts or anchors or swallows. Employing my favorite technique of rectally deriving my statistics, fully 90% of tattoos are clichés, and 90% of those are badly placed and badly executed. And with them, the wearer usually proclaims, “I’m part of a group!” Historically, most ink signifies membership in some (usually seedy) club.

Brachyhypopomus (originally, Hypopomus) pinnicaudatus, a Venezuelan electric fish

One of the all-time great Reese’s Peanut Butter Cup moments in recent cultural history, therefore, is the advent of science tattoos. Nerdy tattoos. Unique images chosen out of passion for one’s calling, designed lovingly late at night over strong coffee and weak beer, collaboratively modeled to sculpt the body region best suited to it, meticulously needled by artisanal craftsmen charging upward of $200 an hour, and worn proudly as a badge of individuality rather than uniformity. (Tattoo aficionadoes are chagrined, and sometimes furious, when they see “their” image on someone else.) Beautiful, sexy tattoos that you can wake up in the morning, stone sober, and look at in the mirror and be glad you got. And do the same 40 years later.

Me, I have a fish on my back. Brachyhypopomus pinnicaudatus, to be both generic and specific. I discovered it in Venezuela in 1987, during a long and traumatic field season. I wrote the paper describing the new species, I wrote a Master’s thesis on it, and I drew the illustration that accompanied the type specimen. It was a painful experience in many ways. That fish came to symbolize both achievement and failure, as well as my first attempt at synthesizing art and science. I carried that experience for 20 years, until I figured out ways to overcome the guilt, shame, and emotional scarring of those first years in grad school. And so I brought my original drawing to the best tattoo artist I could find, Tom Beasley at Dragon Moon Tattoo, and had him ink it on me. Its electric organ discharge, as visualized on an oscilloscope, plays above it on my neck. This body ornament took about 4 hours and cost $600. While Tom’s needles played over my dorsal tissues, I meditated on that experience. As he worked, I felt the weight lifting. Tom lifted that fish off my back, actually.

That, and my other tattoos, are why I pre-ordered Carl Zimmer’s lavish new book, Science ink: tattoos of the science-obsessed. Though bereft of tattoos himself, Zimmer has remarkable empathy for the inked. He gets why we do this. On his blog he collected stories and photographs of science-related tattoos. Zimmer, who writes for Discover magazine, presents the images along with explanations of the science and symbolism behind them. It’s a trove of science knowledge broken appealingly into Reese’s Pieces-sized chunks, and a big bag of eye candy for ink fetishists. These are tattoos that don’t suck.

Zimmer groups the images by discipline: physics, chemistry, natural history, neuroscience, and so on. The tattoos range from dainty anklets to dramatic full backpieces and sleeves. Zimmer is at his best when he walks us through a large, complicated tattoo with many elements. He describes an “ecological allegory” adorning the hip, side, and back of Maureen Drinkard, who wrote her PhD thesis on the bogs of Ohio. He tells us about the bog ecosystem, then describes the cardinal flower on her ribcage, the skunk cabbage that blooms beneath on her hip, the dragonfly she chose as a reminder to be strong and ferocious, and rat-tailed maggot she considers her future. The “ick” reaction some might have to the unromantic rat-tailed maggot is tempered by the “rainbow sheen” it gives off when plucked from the slimy bog and held in the sunlight. Science tattoos are almost always ultimately about beauty.

They are also about facts, which makes these images a playground for a science writer. “Six hundred million years ago,” Zimmer writes about Anthony Pirulli’s full “evo-devo” sleeve,

“a worm-like creature swimming the Precambrian seas used networks of genes to build its body—networks for determining its head-to-tail anatomy, its front-to-back coordinates, its appendages, its organs. That early worm gave rise to many lineages of new kinds of animals, which are still thriving today. And despite their diversity—from insects to squid to starfish to humans—they still use the same basic gene networks to build their bodies. These networks took on new functions through the evolution of the genetic switches that turned the genes on and off. So in a very deep sense, the heart of a fly is much like our own heart. Ever since, Firulli has been studying the functions of some of those genes.”

That’s nice writing. It captures the current understanding of systems biology and embeds it in its evolutionary context, without relying on technical jargon or the dry scientific passive voice. Zimmer gets the science right and expresses it in language a bar-brawling biker can understand.

The book is richly, even extravagantly produced. Though the pages are matte, the photos are mostly high-quality. The cover is in two colors of cloth and has molecular cut-outs, through which neurons, DNA, and microbes peek out. I’m not crazy about the gothic type on the headers, which, I suppose, is meant to evoke 19thcentury German scientific papers. It seems a bit over the top. The text is carefully edited, although in one case a bird is re-classified as a mammal when the South American motmot is listed as a “marmot.” The index is brief but effective; it thoughtfully includes the illustrated organisms and mathematical variables, as well as the names of the doctoral canvases that bear the imagery. Nerds can look up their friends, whether they be researchers or the researched.

Phi, the golden ratio (1.618…)

I was simultaneously proud and a little dismayed that my other science-related tattoo (so far) merits an entry. Phi, the so-called “golden ratio,” is the first irrational number; a constant that, like the more familiar pi (3.1416…), can be carried out to an infinite number of decimal places and thus must always be approximated, its precision foiled by that tantalizing ellipsis. The golden ratio occurs frequently in nature, from the spiral of the chambered nautilus to the whorls of pine cones, sunflowers, and spiral galaxies. Fortunately, none of the four phi tattoos Zimmer presents are just like mine—or as beautiful, in my view. My tattoo has several layers of meaning for me, because I am a nerd, but one of them is as a reminder that mathematics, often called the language of nature, has limitations.

Sometimes natural truth lies not in the number but in the image. Now that’s cool.

 

More wacky science á la Coburn

by

"It's elementary, my dear Crick"Senator Tom Coburn has been attacking what he considers spurious science funded by the National Science Foundation. In a scathing recent report, he skewered grants that supported a robot that folds laundry (an activity recently proven to lead to Nobel Prizes) and taught shrimp how to run on a treadmill. Coburn, who holds a BS in accounting, an MD, and a PhD in BS, knows his science. He told ABC News, “What it says to me is, they have too much money if they’re going to spend money on things like that.”

What else “like that” has grant money been spent on over the years? Funny you should ask. We here at genotopia have compiled, as a public service, a list of insanely useless research that, as it turned out, led to Nobel Prizes. See if you can identify them. Get one point each for correctly identifying the scientist, year of their Nobel, and the scientific topic. Play along and win! Post your score in the comments section to be sure you can claim your prize!

Score:

1-6: Consider yourself an honorary Republican Senator.
7-14: You will receive a copy of Coburn’s memoir, My story and I’m sticking to it, forthcoming from Anal Richards University Press.
15-20: You will be entered in a drawing for a coveted slot as chair of an NIH study section!
21-24: Congratulations! You’ve just been elected Secretary of Labor!

a) For decades, the Carnegie Institution of Washington gave money to an eccentric, prickly loner who eventually stopped publishing altogether, and whose main contribution, if you can call it that, was a study of colored spots in corn!

b) In the early 1950s, the March of Dimes funded a bright but aimless postdoc and a superannuated and feckless British graduate student working in England, paying them to diddle around with Tinker Toys!

c) In the late 1950s, the Jane Coffin Childs Fund supported research on sex in bacteria! This same researcher went on to study life on Mars—the only science which has no subject matter!

d) Countless thousands in federal funding went to a foreign researcher who studied what happens when you poke a sea slug!

e) For more than 40 years, this Caltech scientist was supported in his research into how to create mutant fruit flies!

f) This kooky researcher was supported in what he called the “wonderful experience” of studying brown fat in Syrian golden hamsters! He later proposed the wacky hypothesis of an infectious disease that isn’t caused by any organism!

g) This so-called scientist spent time creating mutants of beer yeast that die when it gets warm! Just keep it in the fridge—it tastes better anyway!

h) This person spent years on the federal dole trying to figure out how many different kinds of garbage a rat can smell!

 

 

 

Answers: a) Barbara McClintock, 1983, transposable genetic elements; b) James Watson and Francis Crick, 1962, DNA double helix; c) Joshua Lederberg, 1958, bacterial conjugation; d) Eric Kandel, 2000, signal transduction in Aplysia; e) Edward B. Lewis, 1995, genetic control of early embryonic development; f) Stanley Prusiner, 1997, prions; g) Leland Hartwell, 2001, cell cycle regulation; h) Linda Buck, 2004, odorant receptors and the organization of the olfactory system.

Dorkins Genome Project a Failure; DNA refuses to be sequenced

by

Jim Watson was the first person to sequence his own genome. Or perhaps it was Craig Venter. Then it was George Church, Misha Angrist, Steven Pinker, the PGP 10, San Francisco 8, and the Jackson 5. Now, Dick Dorkins, evolutionary biologist and President of the atheistic Society for the Prevention of Intelligent design, Theology, Or Other Nonsense (SPITOON) has attempted to sequence his own genome. But it simply can’t be bothered to be sequenced.

Dorkins is best known for his book, The Self-Indulgent Gene (1986), which argued that evolution acts at the level of college students. Keggers, bad tattoos, intramural sports, and sleeping through poli sci seminars, he argued, were simply contemporary expressions of the ancient evolutionary drive to fuck off. Humans, Dorkins wrote, were hard-wired to oversleep for tests, oversell their achievements and ideas, sleep with their best friend’s partner, and get hammered the night before job interviews. Dorkins believes self-promotion and slacking are not only human nature; they are a key driver of natural selection.

The reason lies in our DNA. Early in human evolution, those individuals who did the least work tended to survive to have the most offspring, because while everyone else was out hunting and gathering, the slackers were cuckolding everyone they could get their hairy hands on. As a result, when the rest of the clan returned, the slow, lazy, and generally clueless had appointed themselves chief and controlled the clan.

In sequencing his own genome, Dorkins boldly put his theories to the ultimate test. And his genes spoke. “Dude, WTF?, It’s not even breakfast time,” they said, despite the fact that it was well past noon when researchers ran Dorkins’s DNA through their new high-throughput automated sequencers. And then the sequencers clogged, stalled, and ultimately crashed. Dorkins’s colossally self-centered and bored genes would not be sequenced.

“It was a total mess,” said Dirk Erlenmeyer, a technician at GenesRUs, the company that did the sequencing. “Nucleotides just spilled out onto the floor, As, C, Gs, and Ts, everywhere underfoot, crunching like cockroaches wherever you walked. The floor was literally crawling with DNA.” Doing an an uncanny imitation of Monty Python’s Terry Jones, Erlenmeyer said, “Bleagh!” It has taken days to get the lab cleaned up; it will take even longer to explain what happened.

The result has researchers scrambling for answers. In the early years of genomics, it was believed that long stretches of DNA were too difficult to be sequenced, because they were too repetitive; shotgun sequencing methods were thought useless.

It turns out that large sections of our chromosomes are simply unwilling to be sequenced. According to the results of a Genome-Wide Inference Study (GWIS, pronounced “Gee-whiz”), up to 20 percent of genomes flat-out refuse to be sequenced, whether out of arrogance, petulance, or sheer ennui.

The results could have far-reaching implications. Evolutionary psychologists claim that Dorkins’s self-indulgent gene thesis could explain much about contemporary politics. Preliminary results indicate 95% homology between those intractable regions of Dorkins’s DNA and certain key genes in US Congressmen. Those genes, once labeled “feeblemindedness” in bygone, politically incorrect days, are now included in genome profiles for intelligence. Alas, presence of these sequences have been shown to lower IQ by some 40 points.

Some researchers are claiming that DNA results prove that unenlightened self-interest has taken root at the heart of American politics. “DNA results prove that unenlightened self-interest has taken root at the heart of American politics,” said C. M. Ishmael, author of a potent recent study on thalassophilia.

Science continues to search for answers.

Genome “editors” find Nature writes like middle-schooler

by

Researchers in one of the hottest areas in biotechnology are learning how to edit the genome as if it were a word processing document. And as they do, they’re discovering that nature has the compositional skills of a typical eighth-grader.

As genomics moves ever closer to text editing, copyeditors, English teachers, and literary criticism theorists are flocking to the life sciences. And they don’t always like what they’re finding.

“In my view,” said Maya Primweed, who teaches 8th grade English at Podunk Middle School in East Jesus-By-The-Sea, CT, “the human genome is performing well below grade level.” Adjusting her glasses and clearing her throat significantly, she said, “If it were my student, I would send a note home insisting on a parent conference.”

Primweed estimates that spelling errors alone would lower the human genome’s SAT scores below the threshold of even third-tier colleges. “Maybe a 500 on the verbal test,” she said, clucking her tongue ever so slightly. “On a good day.”

Does God even use Microsoft Word?

Indeed, researchers have noted spelling errors in about one in every three hundred characters—that is, base pairs—in the human genome. Miss Primweed prefers the old-fashioned method of rote drilling to improve spelling accuracy, but she concedes that many of the errors could have been prevented had God simply spellchecked the genome before turning it in. For example, at position 7q on the Y chromosome, Primweed finds, the “dancer” gene, which is associated with a 3% increased risk of excessive thigh muscle mass and a predisposition for lycra, is often misspelled as “cancer.”

Sadly, genome copyeditors are finding in fact that many of the typos lead to cancer. For example, a gene closely linked to MAOA-L4C, associated with thalassophilia, leads to a predisposition to colon cancer in the presence of a diet low in vegetables. A copyeditor from Fort Oowonaginst, Nebraska, suggests that this could explain why pirates have historically tended to die young. “Imagine giving Blackbeard chemotherapy,” she said. “If he could have gone from ‘Avast!’ to Avastin, we might have saved him.”

Not all the DNA typos are tragic, however. The human genome is full of spoonerisms, in which syllables of words or phrases are swapped. In the last two years, GWAS studies have uncovered polymorphisms associated with armatoid rheuthritis, wipe ton biadetes, epsilepy, posteoörosis, fyomardial incarction, and kolypistic Sydney disease. And Norbert Pancake, a freelance indexer from Mos’ Lalanos, Mew Nexico, recently received a grant from the National Institute of English to sequence and analyze the Nomarch flutterby genome. “If there was an intelligent designer,” said Miss Primweed, “I’m beginning to think She was dyslexic.”

Jean’s four common diseases

Primary and secondary school English teachers are also moving into genomics, and are gaining surprising insights into the grammar of life. Punctuation and spelling errors can create serious misunderstandings for DNA polymerases as well as comp. lit. profs.

Comma splices are common as dirt, researchers find them almost every day. That’s the finding of Francis Bowtie, a ninth-grade English teacher from South Nowhere, Iowa, and his collaborator, Erica Islander of MIT. “We’ve found genes on almost every chromosome,” says Bowtie, “that essentially say, ‘It is a serotonin receptor, make it in the prefrontal cortex,’ or ‘It’s a microtubule, keep it in the cytoplasm.’” Genome guru Islander feels fortunate to have a grammarian on his team. “Francis is a much better proofreader than me,” she said. “I didn’t get nothin’ but C’s in English.” “Anything,” Bowtie interjects, pointedly. Bowtie, who minored in the history of science in college, pointed out that such problems could have been avoided if God had adopted Francis Crick’s “comma-free code” instead of the non-overlapping triplet genetic code employed universally throughout the organic world.

Much to their surprise, dangling participles are also popping up in researchers’ findings. Edna Parsewell, a fourth-grade Language Arts teacher is working with Mark Ptosis at Memorial Burger King Hospital in New York City. Promoting expression of a downstream ion channel, they found a regulatory region expressed in women with a TATA box.

And the set of human genes are also prone to problems of, misplaced commas, subject-verb disagreement and beginning a sentence with a preposition—which, some grammarians admit, is disputed as to whether or not it still constitutes a mutation.

Indeed, the new hybrid discipline of grammomics is discovering that nearly every rule of grammar and style can be found broken somewhere in the 3 billion nucleotide pairs that inhabit each of our cells. Transposition of a mobile disrupt element can alter the fragment of a gene’s function. Subject-verb disagreement are frequent. Run-on sentences occur on several chromosomes they disrupt gene function some think they may lead to many diseases. Redundancy is common in gene sequence and widespread in the DNA. And sentence fragments.

High throughput

Finally, professors specializing in literary criticism are addressing the genome as text. “Postmodern genomics or post-genomic modernism: it’s all one,” said Myron Nosehair, of Tweedy College in Elbow Patch, New Hampshire. In his course, “Remedial English and computational genomics: a synergistic dialectic,” Nosehair examines cybertextual problematization as the quintessential cognitive strategy of the bio-digital age. Following the paradigm of French deconstructionism pioneered by Jacques Derrida, Nosehair is analyzing DNA as text.

To illustrate, Nosehair picked a sequence he has been studying, rs6318, a region in the human serotonin receptor:

CCTAATTGGCCTATTGGTTTGGCAAT[C/G]

“This string of nucleotides,” he explains, “this sequential logos, this twisted lineal inscription—ostensibly the signification of natural “truth”—is in fact but an ancestral bias which has sedimented in our culture during the course of history. But consider the sequence. Repetitive. Insistent. Even, at risk of excess emotion, obscurely compulsive. To unmask it is to devalue it—to reclaim our bodies as socio-historical agents, transgressing the liminal constraints of scientific nature. Free of the text, we are free of these constraints.”

“There is nothing outside the sequence.”

Toward a poetics of DNA[1]

Finally, some poets are collaborating with researchers in the field of synthetic biology, creating “living poems,” organisms with meter, sonority, rhetorical devices, and deliberate ambiguity literally in their genes. For example, the poet Tommy Collins has teamed up with synthetic biologist Ahmad Mosque in creating a terpsichorean bacterium. Taking advantage of the fact that bacteria have a single circular chromosome, Collins and Mosque have designed their bug with palindromes, alliteration, onomatopoeia, and full, half, and internal rhyme, with alternating iambic pentameter and heptameter in an AABA form.

AAAATAAACGCAAATTAAACGCAAATAAAA

Although some poetry critics dismiss this work as derivative and lightweight, the genome community has been much warmer in its reception. The tables are turned, however, when it comes to the performance of this living art. Collins will read the sequence of “I, Escherichia wordsworthi” tonight at Pipettes and Prose, a bookstore in Bethesda, MD. Mosque, however, cannot “perform” the poem biologically. “In several places, we had to choose between what could survive in the test tube and what worked poetically,…aaaand, we went with the Art.” The bug, in short, was dead. “It’s the germ of a good idea,” he said. “But it’s just not viable.”

 

[1] Sincere apologies to Judith Roof (2007), The Poetics of DNA, Minneapolis, University of Minnesota Press.