Researchers in one of the hottest areas in biotechnology are learning how to edit the genome as if it were a word processing document. And as they do, they’re discovering that nature has the compositional skills of a typical eighth-grader.

As genomics moves ever closer to text editing, copyeditors, English teachers, and literary criticism theorists are flocking to the life sciences. And they don’t always like what they’re finding.

“In my view,” said Maya Primweed, who teaches 8th grade English at Podunk Middle School in East Jesus-By-The-Sea, CT, “the human genome is performing well below grade level.” Adjusting her glasses and clearing her throat significantly, she said, “If it were my student, I would send a note home insisting on a parent conference.”

Primweed estimates that spelling errors alone would lower the human genome’s SAT scores below the threshold of even third-tier colleges. “Maybe a 500 on the verbal test,” she said, clucking her tongue ever so slightly. “On a good day.”

Does God even use Microsoft Word?

Indeed, researchers have noted spelling errors in about one in every three hundred characters—that is, base pairs—in the human genome. Miss Primweed prefers the old-fashioned method of rote drilling to improve spelling accuracy, but she concedes that many of the errors could have been prevented had God simply spellchecked the genome before turning it in. For example, at position 7q on the Y chromosome, Primweed finds, the “dancer” gene, which is associated with a 3% increased risk of excessive thigh muscle mass and a predisposition for lycra, is often misspelled as “cancer.”

Sadly, genome copyeditors are finding in fact that many of the typos lead to cancer. For example, a gene closely linked to MAOA-L4C, associated with thalassophilia, leads to a predisposition to colon cancer in the presence of a diet low in vegetables. A copyeditor from Fort Oowonaginst, Nebraska, suggests that this could explain why pirates have historically tended to die young. “Imagine giving Blackbeard chemotherapy,” she said. “If he could have gone from ‘Avast!’ to Avastin, we might have saved him.”

Not all the DNA typos are tragic, however. The human genome is full of spoonerisms, in which syllables of words or phrases are swapped. In the last two years, GWAS studies have uncovered polymorphisms associated with armatoid rheuthritis, wipe ton biadetes, epsilepy, posteoörosis, fyomardial incarction, and kolypistic Sydney disease. And Norbert Pancake, a freelance indexer from Mos’ Lalanos, Mew Nexico, recently received a grant from the National Institute of English to sequence and analyze the Nomarch flutterby genome. “If there was an intelligent designer,” said Miss Primweed, “I’m beginning to think She was dyslexic.”

Jean’s four common diseases

Primary and secondary school English teachers are also moving into genomics, and are gaining surprising insights into the grammar of life. Punctuation and spelling errors can create serious misunderstandings for DNA polymerases as well as comp. lit. profs.

Comma splices are common as dirt, researchers find them almost every day. That’s the finding of Francis Bowtie, a ninth-grade English teacher from South Nowhere, Iowa, and his collaborator, Erica Islander of MIT. “We’ve found genes on almost every chromosome,” says Bowtie, “that essentially say, ‘It is a serotonin receptor, make it in the prefrontal cortex,’ or ‘It’s a microtubule, keep it in the cytoplasm.’” Genome guru Islander feels fortunate to have a grammarian on his team. “Francis is a much better proofreader than me,” she said. “I didn’t get nothin’ but C’s in English.” “Anything,” Bowtie interjects, pointedly. Bowtie, who minored in the history of science in college, pointed out that such problems could have been avoided if God had adopted Francis Crick’s “comma-free code” instead of the non-overlapping triplet genetic code employed universally throughout the organic world.

Much to their surprise, dangling participles are also popping up in researchers’ findings. Edna Parsewell, a fourth-grade Language Arts teacher is working with Mark Ptosis at Memorial Burger King Hospital in New York City. Promoting expression of a downstream ion channel, they found a regulatory region expressed in women with a TATA box.

And the set of human genes are also prone to problems of, misplaced commas, subject-verb disagreement and beginning a sentence with a preposition—which, some grammarians admit, is disputed as to whether or not it still constitutes a mutation.

Indeed, the new hybrid discipline of grammomics is discovering that nearly every rule of grammar and style can be found broken somewhere in the 3 billion nucleotide pairs that inhabit each of our cells. Transposition of a mobile disrupt element can alter the fragment of a gene’s function. Subject-verb disagreement are frequent. Run-on sentences occur on several chromosomes they disrupt gene function some think they may lead to many diseases. Redundancy is common in gene sequence and widespread in the DNA. And sentence fragments.

High throughput

Finally, professors specializing in literary criticism are addressing the genome as text. “Postmodern genomics or post-genomic modernism: it’s all one,” said Myron Nosehair, of Tweedy College in Elbow Patch, New Hampshire. In his course, “Remedial English and computational genomics: a synergistic dialectic,” Nosehair examines cybertextual problematization as the quintessential cognitive strategy of the bio-digital age. Following the paradigm of French deconstructionism pioneered by Jacques Derrida, Nosehair is analyzing DNA as text.

To illustrate, Nosehair picked a sequence he has been studying, rs6318, a region in the human serotonin receptor:

CCTAATTGGCCTATTGGTTTGGCAAT[C/G]

“This string of nucleotides,” he explains, “this sequential logos, this twisted lineal inscription—ostensibly the signification of natural “truth”—is in fact but an ancestral bias which has sedimented in our culture during the course of history. But consider the sequence. Repetitive. Insistent. Even, at risk of excess emotion, obscurely compulsive. To unmask it is to devalue it—to reclaim our bodies as socio-historical agents, transgressing the liminal constraints of scientific nature. Free of the text, we are free of these constraints.”

“There is nothing outside the sequence.”

Toward a poetics of DNA[1]

Finally, some poets are collaborating with researchers in the field of synthetic biology, creating “living poems,” organisms with meter, sonority, rhetorical devices, and deliberate ambiguity literally in their genes. For example, the poet Tommy Collins has teamed up with synthetic biologist Ahmad Mosque in creating a terpsichorean bacterium. Taking advantage of the fact that bacteria have a single circular chromosome, Collins and Mosque have designed their bug with palindromes, alliteration, onomatopoeia, and full, half, and internal rhyme, with alternating iambic pentameter and heptameter in an AABA form.

AAAATAAACGCAAATTAAACGCAAATAAAA

Although some poetry critics dismiss this work as derivative and lightweight, the genome community has been much warmer in its reception. The tables are turned, however, when it comes to the performance of this living art. Collins will read the sequence of “I, Escherichia wordsworthi” tonight at Pipettes and Prose, a bookstore in Bethesda, MD. Mosque, however, cannot “perform” the poem biologically. “In several places, we had to choose between what could survive in the test tube and what worked poetically,…aaaand, we went with the Art.” The bug, in short, was dead. “It’s the germ of a good idea,” he said. “But it’s just not viable.”

 


[1] Sincere apologies to Judith Roof (2007), The Poetics of DNA, Minneapolis, University of Minnesota Press.